Telomere

Shopping on line can be easy, simple and save you lots of money. It can also take a lot of your time, frustrate you, and result in unwanted purchases. Now the same can be said for regular high street shopping, but with the vast opportunity presented by the Internet it will pay you to spend a few minutes reading this and understanding how to better optimize your Telomere shopping experience:

1. Compare - without doubt the biggest advantage that the Telomere offers shoppers today is the ability to compare thousands of Telomere at a time. This is a great thing, but not necessarily all the time! Too much can be daunting at times so take advantage of the great comparison sites and where possible let them do the hard work for you.

2. Research - if it has been said it will be on the internet. Ignorance is no longer a justifiable reason for buying the wrong thing. Take the time to research in detail everything that you could possible want to know about

3. Testimonials - don't know anybody that has bought a Telomere? Wrong! If the Telomere is good the internet will let you know. Use the Internet as a friend and get testimonials before you buy.

4. Questions - Got a question about Telomere then search the Forums, FAQ's, Blogs etc. Don't be afraid to ask .....

5. Reputation - Never heard of the company selling Telomere? Don't worry, no reason why you should know every company in the world, but you know someone that does! Use the internet to find out what people are saying about Telomere and build up a picture of their reputation for sales, returns, customer service, delivery etc.

6. Returns - still worried that even after all of the above your Telomere wont be what you want? Check out the returns policy. There is so much competition now that someone, somewhere is bound to offer the terms that you are comfortable with.

7. Feedback - happy with your Telomere then let people know, after all you are depending on others people input in your buying decision, so why not give a little back.

8. Security - check for the yellow padlock on the Telomere site before you buy, and the s after http:/ /i.e. https:// = a secure site

9. Contact - got a question about Telomere, or want to leave a comment then check out the sites contact page. Reputable companies have them and respond.

10. Payment - ready to pay for your Telomere, then use your credit card or PayPal! Be aware of companies that don't accept them, there may be genuine reasons but given the huge amount of choice you have when buying online there is no reason at all not to buy via credit card or PayPal.

A telomere is a region of highly repetitive DNA at the end of a linear chromosome that functions as a disposable buffer. Every time linear chromosomes are DNA replication during late S phase, the DNA polymerase complex is incapable of replicating all the way to the end of the chromosome; if it were not for telomeres, this would quickly result in the loss of vital genetic information, which is needed to sustain a cell (biology)'s activities. Every time a cell with linear chromosomes divides, it will lose a small piece of one of its strands of DNA. This process has been referred to by James D. Watson and Alexei Olovnikov as the "end replication problem" (1971). It is believed that telomeres have a function in the ageing.

Nature and function of telomeres Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. This is because during replication, DNA polymerase can only synthesize DNA in a 5'to 3'direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. At the terminal of the DNA strand, the RNA primer is laid but DNA polymerase cannot extend beyond it. This RNA primer will not later be replaced by DNA, and therefore cannot be translated into gene products or replicated later. Without telomeres at the end of DNA, this genetic sequence would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained.

]

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In ]s, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich. These GC-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes.

In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature DNA replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.

In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2.

A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

Telomere shortening

"Telomeres" shorten because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the Directionality (molecular biology), one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primer (molecular biology)s attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of both the leading and lagging strands.

Extending telomeres The phenomenon of limited cellular division was first observed by Leonard Hayflick. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco.

Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans.

However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, and that by lengthening telomeres we might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).

A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms. A side effect of the mutation was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng et al., 2004).

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Although this is indeed probably so because changing telomere lengths are usually associated with changing speed of senescence, the relationship may well be the other way around, with telomere shortening a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds:

In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. In 2006, Juola et al. reported that in another, unrelated long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed, and more research into the topic is clearly warranted before any firm conclusions can be drawn or even practical applications tested.

Telomere Length Assay Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method involves fluorescent in situ hybridization (FISH). These methods however, require significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. These impediments have been overcome with a novel Real-Time PCR assay for telomere length developed by Richard Cawthon at the University of Utah. This assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demonstrated to be proportional to the average telomere length in a cell (Cawthon 2002). The Real-Time PCR assay has been since redeveloped in a high-throughput 384-well format for use with an Applied Biosystems 7900HT by Jason Wong of the Brigham and Women's Hospital / Harvard Medical School; making the assay feasible for use in large cohort studies. The high-throughput assay has been brought into large epidemiology investigations on genomic DNA samples from healthy subjects by Andrea Baccarelli's lab at the University of Milan.

Telomere sequences {| class="wikitable"|+ Some known telomere sequences|-! Group! Organism! Telomeric repeat (5' to 3' toward the end)|-| Vertebrates], mus musculus, Xenopus laevis| TTAGGG|-| Filamentous fungus| Neurospora crassa]s| Physarum, Didymium (slime mould)| TTAGGG|-| Dictyostelid| AG(1-8)|-| Kinetoplastid protozoa], Crithidia] protozoa| Tetrahymena, Glaucoma (ciliate)| TTGGGG|-| Paramecium], Stylonychia, Euplotes]n protozoa| Plasmodium]s| Arabidopsis thaliana]e| Chlamydomonas]s| Bombyx mori]s| Ascaris lumbricoides]s| Schizosaccharomyces pombe]s| Saccharomyces cerevisiae]| GGGGTCTGGGTGCTG|-| Candida albicans]| GGTGTAGGATGTCACGATCATT|-| Candida maltosa]| GGTGTAC|-| Candida pseudotropicalis]| GGTGTACGGATTTGATTAGGTATGT|}

Telomeres and cancer Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.

References

Juola, Frans A.; Haussmann, Mark F.; Dearborn, Donald C.; Vlek, Carol M. (2006): Telomere shortening in a long-lived marine bird: Cross-sectional analysis and test of an aging tool. Auk (journal) 123(3): 775–783. Digital Object Identifier: 10.1642/0004-8038(2006)1232.0.CO;2 HTML abstract